skcsnlendehuplrusr

    8.6.2022 Experiment genetického inžinierstva: výskumníci vytvorili agresívneho „zombie škrečka“("The Walking Dead"?)

    2022-06-0817:20:03 Zlomený experiment genetického inžinierstva: výskumníci vytvorili agresívneho „zombie škrečka

    V skutočnosti sú škrečky veľmi milé a roztomilé zvieratá. Vedci však teraz zasahovali do genetiky týchto drobných hlodavcov a vytvorili mimoriadne agresívne „zombie škrečky“, ktoré by zaútočili na ich vlastný druh. Ako dlho predtým, než sme skutočne konfrontovaní s "The Walking Dead"? 

    Bez vašej pomoci by sme toto nedokázali. Ďakujeme

    Neziskový sektor: SLSP Názov účtu: Dôstojnosť Slovenska SK28 0900 0000 0051 7971 8989

    Všetky práva vyhradené  ®  OZ Dôstojnosť Slovenska. Zdieľanie dovolené. Zákaz kopírovania!!!

    Vedci si niekedy vytvoria priam „Boží komplex“. Najmä genetikov. Znovu a znovu ich to vedie k experimentom a výskumu, ktoré sú veľmi kontroverzné. Možno si pamätáte novinky z Číny v roku 2018 (1) , kde výskumník tvrdil, že vytvoril prvé dizajnérske bábätká na svete. Títo sú imúnni voči HIV, kiahňam a cholere. Použil na to kontroverznú technológiu CRISPR, ktorá umožňuje odstraňovať, pridávať alebo upravovať špecifické útržky génov.

    O nič lepšia nie je najnovšia správa vedcov, ktorí pomocou tejto technológie skutočne vytvorili „zombie škrečky“. V predmetnej štúdii (2) boli geneticky upravené škrečky použité na štúdium sociálnej neurovedy. V tejto štúdii boli škrečkom odstránené receptory Avpr1a, aby sa zistilo, ako sa zmenilo ich správanie. Tieto receptory zvyšujú prejav sociálnej komunikácie a agresivity. Preto autori predpokladali, že vypnutím týchto signálnych dráh by sa „znížila agresivita aj sociálna komunikácia“. Stal sa však presný opak. V podstate vytvorili zombie škrečky, ktoré útočili na svoj vlastný druh.

    Škrečky začali prenasledovať, pripínať a hrýzť iných škrečkov. Proces úpravy génov spôsobil, že škrečky boli super agresívne voči iným škrečkom rovnakého pohlavia v ich klietke. Autori štúdie napísali: "Neočakávane však škrečky Avpr1a KO vykazovali viac sociálneho komunikačného správania a agresie voči príbuzným rovnakého pohlavia ako ich súrodenci divokého typu (WT).

    Podľa vedcov sa predpokladalo, že Avpr1a zvyšuje agresivitu u mužov, ale znižuje ju u žien. Predchádzajúce štúdie, v ktorých boli receptory stimulované injekciou, priniesli tieto výsledky. Keď sa však gén úplne odstránil, škrečky vykazovali masívnu agresiu, keď boli vystavené neagresívnym škrečkom rovnakého pohlavia v neutrálnej aréne.

    Autori dospeli k záveru, že „rozmanitosť a zložitosť sociálneho správania u rôznych druhov a jednotlivcov vyplýva z funkčných interakcií medzi rôznymi uzlami obvodu SBNN a nie z aktivity jednotlivých komponentov. "Tieto údaje podporujú hypotézu, že sociálne správanie môže byť novou vlastnosťou vyplývajúcou z interakcií medzi uzlami v celom okruhu."

    Ukazuje to tiež, že celé naše bytie (bez ohľadu na to, či ide o iných cicavcov alebo ľudí) je viac než len účinky jednotlivých génov alebo génových úsekov ako takých. Zložitý kód s mnohými interakciami medzi jednotlivými génmi a génovými fragmentmi je oveľa komplikovanejší a rozsiahlejší ako napríklad kód počítačového softvéru. Takže keď vedci začnú odstraňovať ľudský genetický kód, čo vytvárajú? Tiež nejaký "zombie"?

    (1) Tento článok bol publikovaný 26. novembra 2018: Čína možno urobila prvé dizajnérske deti na svete napriek rizikám

    TNW Events - Home | Facebook

    Výskumník z Južnej vedeckej a technologickej univerzity v Číne v Shenzhene tvrdil, že vytvoril prvé génovo upravené dizajnérske deti na svete. Toto tvrdenie je prekvapujúce, pretože etika a bezpečnosť tejto konkrétnej formy úpravy génov sú stále predmetom diskusií.

    Podľa lekárskych dokumentov (1a) zverejnených začiatkom novembra 2018 tím vedený Jiankui He verboval páry, aby vytvorili prvé génovo upravené deti na svete so zvýšenou odolnosťou voči HIV.

    Tvrdenia o experimentálnom postupe

    Pomocou relatívne lacnej a ľahko použiteľnej techniky na úpravu génov s názvom CRISPR/Cas9 tím plánoval eliminovať gén CCR5 v embryách, o čom dúfali, že deti budú odolnejšie voči HIV, cholere a kiahňam. Gén CCR5 bol vybraný, pretože pomáha vytvárať proteínový kanál, ktorý umožňuje HIV – vírusu, ktorý spôsobuje AIDS – vstúpiť do bunky.

    V publikovaných dokumentoch klinických štúdií sa tiež uvádza, že postup úpravy génov sa použil na úpravu embryí pred ich implantáciou do maternice ich matky.

    Antonio Regalado z MIT Technology Review uviedol , že genetické testy boli vykonané na plodoch až po 24 týždňoch alebo šiestich mesiacoch. Nie je však známe, či boli tieto tehotenstvá prerušené, donosené alebo pokračujú.

    Vo videu zverejnenom na YouTube kanáli jeho laboratória však oznámil, že dve dvojčatá Lulu a Nana (mená sa zmenili na ochranu identity) sa pred niekoľkými týždňami narodili zdravé, po úspešnom dokončení procesu úpravy génov.

    Vo videu tiež poznamenal, že celá sekvencia genómu dokázala úspech procesu úpravy génov u detí a „fungoval bezpečne, ako bolo zamýšľané“.

    https://youtu.be/th0vnOmFltc

    Aj keď je to pravda, je otázne, či je bezpečnosť, ktorú tvrdí, dlhodobo použiteľná.

    Aká bezpečná je úprava génu CRISPR/Cas9?

    V júli 2018 bol vo vedeckom časopise Nature Biotechnology publikovaný článok , ktorý varoval pred použitím technológie CRISPR/Cas9 na úpravu génov. V štúdii laboratórne experimenty s použitím myších a ľudských buniek odhalili, že technika CRISPR/Cas9 „často“ spôsobuje „rozsiahle“ génové mutácie.

    Po zverejnení výskumu spoluautor článku Allen Bradley z Wellcome Sanger Institute v Anglicku napísal:

    Je dôležité, aby každý, kto uvažuje o použití tejto technológie na génovú terapiu, postupoval opatrne a veľmi pozorne skontroloval škodlivé účinky.

    Mukund Thattai, bunkový biológ z indického Národného centra biologických vied, ktorý nebol zapojený do výskumu, sa na Twitteri vyjadril, aby vyjadril svoj názor na tento príbeh. Napísal:

    Každý gén v našom genóme má „prostredie“ určené všetkými ostatnými génmi. Gény „interagujú“ zložitými spôsobmi, z ktorých len niektorým rozumieme. Takže zmena JEDNOHO génu by mohla zmeniť prostredie nejakého iného génu.

    Ďalšie jeho názory na tento kontroverzný experiment nájdete vo vlákne Thattaiho na Twitteri:

     

    Ewan Birney, bioinformatik v Európskom laboratóriu molekulárnej biológie a člen Kráľovskej spoločnosti, sa na Twitteri podelil o svoje myšlienky o budúcom riziku a uskutočniteľnosti úpravy génov CRISPR/Cas9. Napísal : _

    Určite existuje možnosť, že by sa to mohlo v budúcnosti zmeniť, ale je dôležité, aby sa to dialo v kontexte dobrej regulácie, ktorej spoločnosť môže dôverovať a zároveň umožňuje inovácie.

    Ako teda vyzerá budúcnosť úpravy génov?

    Až doteraz neexistovalo žiadne nezávislé potvrdenie Jeho tvrdenia. Pokiaľ nie sú úplné výsledky štúdie publikované v časopise a nie sú predmetom vzájomného hodnotenia, úspešnosť postupu a deklarovaná bezpečnosť procesu sú otázne. A keďže ide o obrovské tvrdenie, určite si vyžaduje mimoriadny dôkaz.

    Spojené kráľovstvo a USA, okrem iných krajín , už zakázali experimentálne úpravy génov pri pokusoch na ľuďoch. To viedlo niektorých odborníkov k obavám , že relatívny nedostatok predpisov v Číne by ju mohol zmeniť na centrum lekárskej turistiky na úpravu génov.

    Možno budete chcieť bližšie sledovať novinky o úprave génov, pretože sa zdá, že na nich skutočne spočíva budúcnosť ľudstva. A ak chcete porozumieť kontroverzii okolo úpravy génov prostredníctvom zábavného vysvetľovača, odporúčame vám epizódu Johna Olivera Last Week Tonight.

    (1a) Lekárske dokumenty

    Chinese Clinical Trial Register (ChiCTR) - The world health organization  international clinical trials registered organization registered platform
     

    (2) Úprava CRISPR-Cas9 receptora arginín-vazopresín V1a spôsobuje paradoxné zmeny v sociálnom správaní u sýrskych škrečkov

    Logo PNAS

    Editoval Donald Pfaff, Rockefeller University, New York, NY; prijaté 18. novembra 2021; prijaté 31. marca 2022

    Význam

    Arginín-vazopresín (AVP) pôsobiaci na receptory V1a (Avpr1as) predstavuje kľúčový signálny mechanizmus v mozgovom okruhu, ktorý zvyšuje prejav sociálnej komunikácie a agresivity. Vyrobili sme sýrskych škrečkov, ktorým úplne chýba Avpr1as ( škrečky Avpr1a knockout [KO]) pomocou systému CRISPR-Cas9, aby sme lepšie preskúmali úlohu Avpr1a vo vyjadrení sociálneho správania. Potvrdili sme neprítomnosť Avpr1as u týchto škrečkov preukázaním 1) úplného nedostatku väzby na špecifický receptor Avpr1a v mozgu, 2) behaviorálnej necitlivosti na centrálne podávaný AVP a 3) absenciou dobre známej odozvy krvného tlaku vyrobené aktiváciou Avpr1as. Nečakane však Avpr1aKO škrečky vykazovali viac sociálneho komunikačného správania a agresie voči príbuzným rovnakého pohlavia ako ich súrodenci divokého typu (WT).

    Abstraktné

    Štúdie z rôznych druhov naznačujú, že arginín-vazopresín (AVP) a jeho receptor V1a (Avpr1a) zohrávajú rozhodujúcu úlohu pri regulácii celého radu sociálneho správania prostredníctvom svojich činností v neurónovej sieti sociálneho správania. Aby sme ďalej preskúmali úlohu AVPR v sociálnom správaní, vykonali sme úpravu génu Avpr1a sprostredkovanú CRISPR- Cas9 prostredníctvom pronukleárnych mikroinjekcií u sýrskych škrečkov ( Mesocricetus auratus ), čo je druh široko používaný v behaviorálnej neuroendokrinológii, pretože produkuje bohatú sadu sociálneho správania. . Použitím tohto prístupu na úpravu génov zárodočnej línie sme vygenerovali stabilnú líniu škrečkov s mutáciou posunu rámca v géne Avpr1a , čo viedlo k nulovej expresii funkčného Avpr1as. Avpr1aknockoutované (KO) škrečky vykazovali úplný nedostatok Avpr1a-špecifickej autorádiografickej väzby v celom mozgu, behaviorálnu necitlivosť na centrálne podávaný AVP a žiadnu presorickú odpoveď na periférne injikovaného Avpr1a-špecifického agonistu, čím sa potvrdila absencia funkčného Avpr1as v mozgu a periférie. V rozpore s očakávaniami, Avpr1aKO škrečky vykazovali podstatne vyššie úrovne sociálnej komunikácie v rovnakej miere (tj pachom stimulované označenie boku) ako ich súrodenci divokého typu (WT). Okrem toho chýbali rozdiely medzi pohlaviami v agresii, pretože mužské aj ženské KO vykazovali väčšiu agresiu voči súrodencom rovnakého pohlavia ako ich súrodenci WT. Celkovo tieto údaje zdôrazňujú dôležitosť porovnávacích štúdií využívajúcich prístupy na úpravu génov a naznačujú prekvapivú možnosť, že modulácia neurálnej siete sociálneho správania špecifická pre Avpr1a môže byť viac inhibičná ako tolerantná.
    Kľúčovou výzvou v sociálnej neurovede je pochopiť, ako gény pôsobia v rámci definovaných nervových okruhov na reguláciu sociálneho a afektívneho správania. Neurónová sieť sociálneho správania (SBNN) je komplexný okruh zložený z prepojených sérií oblastí mozgu alebo „uzlov“, ktoré riadia mnohé sociálne správanie, od strachu a agresie až po príslušnosť ( 1 – 4 ). Predpokladá sa, že veľká časť diverzity a zložitosti sociálneho správania naprieč druhmi a medzi jednotlivcami vzniká z funkčných interakcií prvkov celého okruhu SBNN, a nie z aktivity jeho jednotlivých komponentov ( 3 , 5). Na riešenie toho, ako sa sociálne správanie vynára z takejto komplexnej neurónovej siete, je nevyhnutné mať pokročilé genetické nástroje schopné manipulovať kľúčové neurochemické dráhy v celom okruhu a byť schopné porovnať účinky týchto manipulácií u rôznych druhov, ktoré vykazujú bohaté a rôzne vzorce sociálneho správania.
    V tejto štúdii sme použili prístup na úpravu pronukleárneho génu zárodočnej línie CRISPR-Cas9 u sýrskych škrečkov ( Mesocricetus auratus ), aby sme eliminovali receptory arginín-vazopresín (AVP) V1a (Avpr1as) v uzloch SBNN ( 6 – 8 ) . . Sýrske škrečky sa vo veľkej miere používajú v štúdiách sociálnej neurovedy kvôli ich dobre popísaným vzorcom sociálneho správania a sú to druhy, u ktorých bolo prvýkrát preukázané, že AVP reguluje sociálne správanie ( 9). Následné farmakologické štúdie s použitím vysoko selektívnych agonistov a antagonistov pre Avpr1as u škrečkov, ako aj u iných druhov, ako sú hraboše a myši, posilnili kritickú úlohu AVP a Avpr1as pri regulácii diskrétneho sociálneho správania, vrátane agresie a sociálnej komunikácie ( 10 – 13 ). Napriek značnému množstvu dôkazov, že Avpr1as reguluje agresiu u niekoľkých druhov hlodavcov, vrátane myší, zistilo sa, že agresia, ktorú prejavujú Avpr1a knockout (KO) samce (M) myší, sa nelíši od agresie produkovanej kontrolami divokého typu (WT) ( 14). Aby sme podrobnejšie preskúmali funkčnú úlohu Avpr1as pri riadení sociálneho správania u škrečkov, využili sme nedávno sekvenovaný transkriptóm škrečka, aby sme navrhli konštrukt Cas9/single-guide RNA (sgRNA) zacielený na štartovací kodón génu škrečka Avpr1a ( 15 , 16 ). Prekvapivo tu uvádzame, že globálne vymazanie génu škrečka Avpr1a paradoxne zvyšuje agresivitu a sociálnu komunikáciu.

    Výsledky

    CRISPR-Cas9 Indels.

    Injekcie plazmidu sgRNA/Cas9 zacieleného na gén Avpr1a do embryí škrečkov produkovali rôzne indely v cieľovom mieste a okolo neho u škrečkov, ktorí prežili do odstavenia ( obr. 1). Z týchto škrečkov mala jedna samica (F) (C1) alelu WT a deléciu 47 párov báz začínajúcu 16 báz proti smeru od štartovacieho kodónu a končiacu 28 báz po smere od štartovacieho kodónu a produkovala dva vrhy s WT siarov. U všetkých jej potomkov sa však zistilo, že majú buď deléciu 11- alebo 10-páru báz, ktorá sa následne preniesla na ich potomstvo (generácie F2, F3 a F4). Tieto výsledky naznačujú, že zakladateľ (C1) pravdepodobne vykazoval somatickú mozaiku. Štartovací kodón je prítomný v deléciách s 11 pármi báz a 10 párov báz, ale oba produkovali mutáciu s posunom rámca, čo vedie k predčasnému stop kodónu. Analýza mimo cieľ sa uskutočnila so škrečkami F3 a F4 po dvoch kríženiach heterozygot × WT. Identifikovalo sa šesť potenciálnych mimocieľových génov ( tabuľka 1). Z nich sme boli schopní amplifikovať, subklonovať a sekvenovať PROB1 ( n = 3) a SCARF2 ( n = 2) z KO škrečkov so sekvenovaním, ktoré odhalilo presnú zhodu so zodpovedajúcou sekvenciou WT z referenčného genómu.
    Obr.
    Injekcie plazmidu sgRNA/Cas9 zacieleného na gén Avpr1a do embryí škrečkov. ( A ) Zarovnania rôznych indelov vytvorené úpravou CRISPR-Cas9. Iba C1 FOUNDER bol schopný splodiť potomstvo, výsledkom čoho boli generácie F1 a F2. ( B ) Predpokladané proteíny produkované indelmi. ( C ) F ( horná časť každej fotografie) a M ( dolná časť každej fotografie) Avpr1a KO ( pravá strana každej fotografie) nevykazujú žiadne zjavné fyzické rozdiely v porovnaní s WT ( ľavá strana každej fotografie).
    OTVORIŤ V PREHRÁVAČI
    Stôl 1.
    Potenciálne mimocieľové gény
    Rozbaliť tabuľku
    gRNA GACAGCATGAGTTTCCCGCGAGG
    Šatka2 –––––––––––––GTTTCCCGCGCGG
    Paics ––––––––––––––TTTCCCGCGCGG
    PROB1 –––––––––––––GTTTCCCGCGAGG
    Pyurf ––––––––––GAGTTTCCCGCGGGG
    Hoxa10 ––––––––––––––TTTCCCGCGGGG
    Dus3l ––––––––––––––TTTCCCGCGTGG
      ********* **
    ROZBALIŤ PRE VIAC
    OTVORIŤ V PREHRÁVAČI

    Väzba Avpr1a chýba u škrečkov KO a je znížená u heterozygotov.

    Na potvrdenie neprítomnosti funkčného Avpr1as sme najprv použili receptorovú autorádiografiu, aby sme určili, či narušenie génu Avpr1a viedlo k strate špecifickej väzby Avpr1a v mozgu. Autorádiogramy odhalili, že špecifická väzba Avpr1a neexistovala v mozgoch M a F homozygotných KO ( obr. 2 A a C ). Štatistická analýza špecifickej väzby Avpr1a odhalila výrazne nižšiu väzbu v KO ako u heterozygotných alebo WT škrečkov vo vybraných oblastiach mozgu bohatých na Avpr1a a/alebo o ktorých je známe, že sa podieľajú na sociálnom správaní ( 6 , 7 ), vrátane laterálnej priehradky [LS; F (2,11) = 57,79, P< 0,001, eta2 = 0,913), mediálne preoptické jadro [MPN; F (2,11) = 39,10, P < 0,001, eta2 = 0,88], predný hypotalamus [AH; F (2,11) = 52,48, P < 0,001, eta2 = 0,91], ventromediálny hypotalamus [VMH; F (2,11) = 148,7, P < 0,001, eta2 = 0,96] a paraventrikulárne jadro [PVN; F (2,11) = 184,09, P < 0,001, eta2 = 0,97] ( obr. 2A ). Analýza lôžka nucleus stria terminalis [BNST; F (1,6) = 3,218, P = 0,123], anterodorzálny talamus [AD; F (1,7) = 12,66, P= 0,009, eta2 = 0,64] a mediálna amygdala [ F (1,7) = 24,52, P = 0,002, eta2 = 0,78] porušili predpoklad heteroskedasticity v dôsledku nízkej variability medzi KO v porovnaní s WT a heterozygotmi, a tak tu uvedené štatistiky predstavujú porovnania iba medzi WT a heterozygotmi. Tieto oblasti však sledovali vzor väzby Avpr1a podobný iným oblastiam, v ktorých väzba v KO neexistovala. Vo všetkých skúmaných oblastiach, s výnimkou BNST a LS, mali heterozygoti hustotu väzby, ktorá bola medzi KO a WT. V PVN bola tiež interakcia genotyp × pohlavie, v ktorej M mal vyššiu hustotu väzby Avpr1a ako F medzi WT, ale tento rozdiel nebol zjavný medzi heterozygotmi alebo KO [ F ​​(2,11) = 7,58,P = 0,009, eta2 = 0,58].
    Obr.
    Lokalizácia Avpr1a a Oxtr s receptorovou autorádiografiou. ( A ) Kvantifikácia (rozpady za minútu na 0,04 mg štandardu) väzby Avpr1a v regiónoch dôležitých pre sociálne správanie alebo v regiónoch s veľkým počtom Avpr1as. Pruhy spojené čiarami a * označujú významné post hoc rozdiely. Pruhy spojené čiarami a # označujú významné rozdiely medzi pohlaviami. Označenie „a“ znamená, že KO boli vylúčené z ANOVA. ( B ) Kvantifikácia väzby Oxtr v regiónoch dôležitých pre sociálne správanie alebo v regiónoch s veľkým počtom Oxtrov. ( C ) Reprezentatívne mikrofotografie Avpr1a ( horné ) a Oxtr ( dolné ) od škrečkov WT, heterozygotov (Het) a KO. Čísla vo vnútri alebo nad pruhmi označujún . OVTA, analóg ornitín vazotocínu; LVA, lineárny antagonista vazopresínu.
    OTVORIŤ V PREHRÁVAČI
    Aby sme preskúmali špecifickosť narušenia Avpr1as, skúmali sme tiež hustotu a distribúciu väzby na receptor blízko príbuzného oxytocínového receptora (Oxtr) v častiach mozgu susediacich s tými, kde sa analyzovala väzba Avpr1a ( obr. 2 B a C ). Na rozdiel od Avpr1a neboli žiadne rozdiely medzi KO, heterozygotmi a WT, pokiaľ ide o špecifickú väzbu Oxtr v rôznych oblastiach mozgu bohatých na Oxtrs [centrálna amygdala (CeA), F (2,11) = 0,072, P = 0,931, η 2 = 0,013; dorzálny endopiriformný kortex (DEn), F (2, 11) = 0,015, P = 0,985, η 2 = 0,003] alebo v regiónoch spojených so sociálnou komunikáciou [AH,F (2,11) = 0,001, P = 0,999, n2 = 0,000; MPN, F (2,10) = 0,705, P = 0,517, n2 = 0,124] ( 6 , 7 ) Nezistil sa žiadny hlavný účinok interakcie pohlavia alebo genotyp x pohlavná interakcia pre žiadnu oblasť mozgu alebo typ receptora (všetky F < 1,40; všetky P > 0,261).

    Avpr1a-sprostredkovaná regulácia krvného tlaku sa v KO škrečkoch stráca.

    Aby sme ďalej potvrdili absenciu funkčného Avpr1a u škrečkov Avpr1a KO, skúmali sme dobre známy účinok aktivácie Avpr1a na krvný tlak ( 17 , 18 ). Zvyšovanie krvného tlaku je kritickou funkciou periférnych Avpr1as; testovali sme teda hypotézu, že „presorový“ účinok Avpr1as je narušený u škrečkov Avpr1a KO. Liečba vysoko selektívnym agonistom Avpr1a (Phe2OVT) krátko, ale výrazne zvýšila systolický krvný tlak u WT [ F (9 189) = 2,18, P = 0,025, η 2 = 0,094; Obr. 3]. Systolický krvný tlak bol významne vyšší počas meraní po systémovej injekcii Phe2OVT v porovnaní s fyziologickým roztokom, po ktorom sa krvný tlak vrátil na úrovne podobné tým po injekcii fyziologického roztoku. Na rozdiel od toho, injekcia Phe2OVT u škrečkov Avpr1a KO neovplyvnila systolický krvný tlak u M alebo F. Neexistovala žiadna interakcia genotyp × pohlavie × liečba × meranie [ F (9 189) = 0,96, P = 0,471, η 2 = 0,044].
    Obr.
    Systolický krvný tlak z anestetizovaných škrečkov WT (7 F, 7 M) a Avpr1a KO (5 F, 6 M), ktorým bol IP injikovaný fyziologický roztok alebo selektívny agonista Avpr1a (Phe2OVT). Injekcie sa uskutočnili pri meraní 0 a každé meranie trvalo približne 1 minútu. * Označuje významný post hoc rozdiel oproti fyziologickému roztoku.
    OTVORIŤ V PREHRÁVAČI

    Značenie bokov stimulované AVP je u KO škrečkov zrušené.

    Ďalej sme potvrdili, že absencia Avpr1as u škrečkov Avpr1a KO eliminovala schopnosť Phe2OVT vyvolať sociálnu komunikáciu, konkrétne označenie boku. Značenie boku komunikuje rôzne spoločensky dôležité informácie, ako je stav dominancie a výber partnera ( 19 , 20 ). Škrečky sa označujú na boku počas sociálnych interakcií a v reakcii na pachy rovnakého druhu. Existujú značné dôkazy zo štúdií štruktúry a aktivity a podávania vysoko selektívnych agonistov a antagonistov Avpr1a, že centrálne podávaný AVP stimuluje značenie boku pôsobením cez Avpr1as ( 21 , 22). Aby sme otestovali, či toto správanie sprostredkované Avpr1a zostáva v neprítomnosti Avpr1a, vstrekli sme AVP, Phe2OVT a fyziologický roztok vo vyváženom poradí do komôr škrečkov M a F KO a WT. AVP a Phe2OVT vyvolali robustné označenie boku vo WT M a F v porovnaní s fyziologickým roztokom. Na rozdiel od toho ani AVP ani Phe2OVT nestimulovali značenie boku v KO M alebo F v porovnaní s injekciou fyziologického roztoku [ F (2, 14) = 10,598, P < 0,001, η 2 = 0,43; Obr. 4] . Nezistila sa žiadna interakcia genotyp x pohlavie [ F (2,28) = 1,371, P = 0,242, η2 = 0,89].
    Obr.
    Značenie boku u škrečkov WT a Avpr1a KO vyvolané liekmi. Škrečky boli injikované tesne pred umiestnením do čistej klietky. Pruhy spojené čiarami označujú významné post hoc rozdiely. Čísla vo vnútri alebo nad pruhmi označujú n . Sal, fyziologický roztok.
    OTVORIŤ V PREHRÁVAČI

    Pachom stimulované značenie na boku sa vyskytuje na vyšších úrovniach v KO ako u WT škrečkov.

    Vzhľadom na farmakologické dôkazy, že centrálne podávaný AVP pôsobí prostredníctvom Avpr1as na vyvolanie označovania boku, testovali sme hypotézu, že úplná absencia Avpr1as by tiež eliminovala expresiu označovania boku stimulovaného zápachom. Prekvapivo, všetky škrečky, bez ohľadu na genotyp, vykazovali robustné označenie boku, keď boli vystavené pachom rovnakého pohlavia, pričom KO značili približne dvakrát toľko ako WT. Tieto rozdiely sa premietli do významného hlavného účinku genotypu [ F (2,41) = 5,156, P = 0,01, eta2 = 0,201; Obr. 5A ] . Nevyskytla sa žiadna interakcia genotyp x pohlavná sústava [ F (2,41) = 0,594, P= 0,557, eta2 = 0,028]. Nakoniec sme skúmali, či expresia označenia boku u škrečkov KO vyžaduje prítomnosť sociálnej stimulácie (tj rovnaký zápach). Zatiaľ čo bok škrečkov KO označil viac ako WT v klietkach označených zápachom, ani KO, ani bok WT nebol označený v neprítomnosti konšpecifických pachov [genotyp × efekt stavu; F (2,31) = 5,443, P = 0,009, eta2 = 0,260; Obr. 5B ] .
    .
    Obr.
    Značenie boku a agresivita u škrečkov WT, heterozygotov (Het) a KO. ( A ) Značenie boku vykazované škrečkami WT, heterozygotmi a KO, keď boli vystavené klietke, ktorá bola predtým označená škrečkom rovnakého pohlavia. ( B ) Značenie boku vykazovali škrečky WT, heterozygoti a KO vystavené čistým klietkam označeným zápachom. ( C ) Agresia prejavovaná WT, heterozygotmi a KO škrečkami, keď sú vystavené konšpecifickým osobám rovnakého pohlavia. Pruhy spojené zátvorkami a čiarami označujú významné post hoc rozdiely. Čísla vo vnútri čiar alebo vyššie označujú n . ( D ) Reprezentatívne obrázky správania. V i a ii , M bok škrečka označuje roh klietky z plexiskla. V iiiiv , väčšie F útočí a pripína menšie F.
    OTVORIŤ V PREHRÁVAČI

    KO Škrečky vykazujú zvýšenú agresivitu.

    Agresívne správanie u škrečkov je vysoko stereotypné a prejavuje sa na vysokej úrovni u M aj Ž ( 23 ). Aktivácia Avpr1a má pohlavne špecifické účinky na agresivitu u M a F, pričom aktivácia Avpr1a zvyšuje agresivitu u M a znižuje agresivitu u F ( 24 – 26 ). Všetky škrečky, bez ohľadu na genotyp alebo pohlavie, vykazovali agresivitu (celkové trvanie: prenasledovanie, hryzenie a prichytávanie), keď boli vystavené neagresívnemu jedinci rovnakého pohlavia v neutrálnej aréne. Okrem toho bol zaznamenaný významný hlavný účinok genotypu [ F (2,41) = 5,406, P = 0,008, eta2 = 0,209; Obr. 5C ]pričom škrečky M a F KO vykazujú väčšiu agresivitu ako WT alebo heterozygotní škrečky. Heterozygoti M a F sa nelíšili od WT v prejave agresivity. Nezistila sa žiadna interakcia genotyp x pohlavie [ F (2,41) = 0,938, P = 0,400, eta2 = 0,044]. Genotyp nemal žiadny vplyv na latenciu spustenia agresie [ F (2,41) = 2,415, P = 0,102, eta2 = 0,11]. Bol tu však významný hlavný vplyv pohlavia, pričom F (priemer = 79,11, SEM ± 19,3 s) spustil agresiu skôr ako M [priemer = 145,2, SEM ± 21,3 s; F (1,41) = 5,28, P = 0,027, eta2 = 0,114].

    Diskusia

    Tu uvádzame úspešné použitie CRISPR-Cas9 na generáciu sýrskych škrečkov Avpr1a KO. Prostredníctvom šľachtenia zakladateľa a heterozygotného potomstva upraveného CRISPR-Cas9 sme boli schopní úspešne produkovať M a F sýrskych škrečkov, ktorým úplne chýba funkčný gén Avpr1a . Škrečky Avpr1a KO vykazovali 1) úplný nedostatok väzby Avpr1a v mozgu, 2) necitlivosť na behaviorálne účinky centrálne podávaného AVP a 3) žiadne zmeny krvného tlaku v reakcii na periférne injikovaného agonistu Avpr1a. Napriek týmto očakávaným zmenám je pozoruhodné, že škrečky Avpr1a KO exprimovali dvojnásobné úrovne označovania boku stimulovaného zápachom a agresie voči príbuzným rovnakého pohlavia ako WT.
    Dôležité je, že sme preukázali haploinsuficienciu v označovaní boku a agresívnom správaní a vo väzbe Avpr1a v mozgu, čo naznačuje, že heterozygoti budú užitoční na skúmanie účinkov zníženej, ale nie neprítomnej expresie Avpr1a. Translačný význam behaviorálnych genetických prístupov by sa mal zlepšiť zvýšením rozmanitosti zvieracích modelov a prístupov a tieto výsledky demonštrujú užitočnosť úpravy génu CRISPR-Cas9 u sýrskych škrečkov na skúmanie funkcie génu. Porovnanie behaviorálnych genetických údajov získaných od netradičných modelových druhov s údajmi získanými u KO myší (napr. účinky na agresivitu) poskytuje dôležitý kontext, ktorý môže pomôcť zovšeobecniť zistenia na iné hlodavce alebo na ľudí. Počas generovania a fenotypovania tu opísaných škrečkov sa KO vygeneroval prostredníctvom CRISPR-Cas9 u hrabošov prériových (27 ). Je pozoruhodné, že týmto hrabošom chýba funkčný gén Oxtr a vďaka vzťahu medzi Oxtrs a Avpr1a poskytujú užitočné porovnanie s našimi výsledkami u škrečkov. U oboch druhov CRISPR-Cas9 indukoval mozaiky u upravených zvierat. Mozaicizmus po úprave génu sprostredkovaného Cas9 nie je nezvyčajný ( 28 – 30 ) a pri generovaní nového modelu KO podčiarkuje hodnotu starostlivého selektívneho šľachtenia upravených zakladateľov a potomkov. Porovnania medzi druhmi pravdepodobne poskytnú nový pohľad na funkciu a vývoj rôznych molekulárnych substrátov správania.
    Značenie boku hrá u škrečkov rozhodujúcu úlohu v sociálnej komunikácii. M a F škrečky na boku v reakcii na pachy rovnakého pohlavia alebo na hypotalamickú injekciu AVP bez rovnakých pachov ( 9 , 22 , 31 ). V tejto štúdii sme opäť ukázali, že intracerebroventrikulárna (ICV) injekcia AVP alebo selektívneho agonistu Avpr1a u škrečkov WT vytvorila robustné označenie boku v prostrediach bez zápachu; avšak ICV injekcia AVP alebo selektívneho agonistu Avpr1a u škrečkov Avpr1a KO nemala žiadny vplyv na expresiu označenia boku, čo dokazuje necitlivosť KO na exogénny AVP. Prekvapivo sme zistili, že značenie boku stimulované zápachom bolo dvojnásobne vyššie v Avpr1aKO škrečkov ako u škrečkov WT. Toto zvýšenie bolo špecifické pre prítomnosť rovnakého zápachu, pretože Avpr1a KO škrečky boli v čistej klietke rovnako nízke ako WT škrečky. Tieto zistenia naznačujú, že aktivácia Avpr1a nie je potrebná na expresiu označenia boku stimulovaného zápachom. Súčasné údaje skutočne nie sú jediné, čo naznačuje, že môže dôjsť k nesúladu medzi počtom Avpr1as a expresiou označenia boku. Bývanie v „letných“ fotoperiódach (tj > 12 hodín svetla denne) dramaticky zvyšuje expresiu hypotalamického Avpr1as v porovnaní s „zimnými“ fotoperiódami ( 32 ). Je však zaujímavé, že značenie boku stimulované zápachom a AVP je vyjadrené na rovnakých úrovniach, bez ohľadu na fotoperiódu ( 11 ,33 ). Mechanizmy zodpovedné za oddelenie označenia boku od počtu hypotalamických Avpr1as u škrečkov s krátkou fotoperiódou nie sú známe, hoci fotoperiódou indukované kompenzačné zmeny v reakcii na neurochemické signály, ako je serotonín alebo galanín, ktoré môžu ovplyvniť označenie boku nezdá sa, že by sa na tom podieľali ( 34 ). Iste, skúmanie kompenzačných mechanizmov, ktoré sprostredkovávajú robustné, zápachom stimulované označenie boku v Avpr1aKO škrečky sú nevyhnutným ďalším krokom. Celkovo tieto údaje naznačujú, že aj keď je prítomnosť Avpr1as nevyhnutná na to, aby exogénny AVP vyvolal značenie boku, Avpr1as nie sú potrebné na expresiu značenia na boku stimulovaného zápachom; je teda jasné, že neurochemické mechanizmy regulujúce značenie boku sú zložitejšie, ako sa doteraz predpokladalo.
    Ďalšie zaujímavé a prekvapivé zistenie sa objavilo, keď sme skúmali výsledok eliminácie funkčného Avpr1as na agresívnom správaní. Predchádzajúce štúdie zistili, že injekcia AVP do AH stimuluje agresiu u škrečkov M a inhibuje agresiu u škrečkov F a že injekcia selektívneho antagonistu Avpr1a do AH inhibuje agresiu u škrečkov M a stimuluje agresiu u škrečkov F ( 13 , 24 , 25 ) . Preto sme predpovedali, že neprítomnosť Avpr1as by znížila agresiu u M a zvýšila agresiu u škrečkov F. Ako sa predpokladalo, agresivita bola vyššia v Avpr1a KO F ako vo WT a agresia u heterozygota F bola stredná v porovnaní s agresiou pozorovanou v KO a WT F. V Avpr1aKO M však bola agresivita neočakávane vyššia ako u heterozygotov alebo WT. Agresivita bola skutočne dvojnásobne vyššia u škrečkov M Avpr1a KO ako u WT M. Eliminácia funkčných Avpr1as teda eliminovala predtým zistené rozdiely medzi pohlaviami v agresii sprostredkovanej AVP. Tieto údaje sú v súlade s hypotézou, že Avpr1as majú inhibičné účinky na agresiu u F a zvyšujú možnosť, že globálna strata funkčných Avpr1as môže zvýšiť agresivitu u M. Je zaujímavé, že agresivita sa výrazne zvyšuje u škrečkov M a F vystavených krátkym fotoperiódam v porovnaní s škrečkami umiestnené v dlhých fotoperiódach ( 35 , 36 ), v rámci ktorých dochádza k zníženiu Avpr1as v kľúčových lokalitách SBNN ( 32 ,33 ). Podobne ako zvýšenie agresie pozorované u škrečkov Avpr1a KO M, zvýšená agresivita u škrečkov M vystavených krátkodobej fotoperióde nezávisí od aktivácie Avpr1as ( 37 ). Zvýšenie agresivity vyvolané krátkou fotoperiódou môže byť výsledkom zmien v sekrécii epifýzového melatonínu, ktoré slúžia na zvýšenie agresivity ( 38 – 42 ), a bude zaujímavé zistiť, či M Avpr1a KO majú podobné kompenzačné zvýšenia sekrécie melatonínu .
    Ako už bolo uvedené vyššie, predpokladá sa, že rôznorodosť a zložitosť sociálneho správania medzi druhmi a medzi jednotlivcami vyplýva z funkčných interakcií medzi viacerými uzlami obvodov SBNN, a nie z aktivity jeho jednotlivých komponentov ( 3 , 5 ).). Skúmanie neurocircuitry SBNN bolo obmedzené takmer výlučne na štúdie toho, ako jednotlivé uzly ovplyvňujú sociálne správanie z dôvodu neschopnosti súčasne manipulovať s celým okruhom. Globálne KO, ako sú tie, ktoré sa používajú v tejto štúdii, poskytujú jeden prístup, aj keď nedokonalý, na manipuláciu kľúčových neurochemických signálov v celom okruhu. Dramatické rozdiely v agresii a sociálnej komunikácii medzi škrečkami KO a WT pozorované v tejto štúdii neboli predpovedané štúdiami využívajúcimi farmakologickú inhibíciu aktivity Avpr1a v špecifických uzloch SBNN. Preto eliminácia aktivity Avpr1a v celom okruhu SBNN môže ovplyvniť sociálne správanie veľmi odlišne ako inhibícia aktivity Avpr1a v jednotlivých uzloch okruhu. ako taký, tieto údaje podporujú hypotézu, že sociálne správanie môže byť vznikajúcou vlastnosťou pochádzajúcou z interakcií medzi uzlami celého okruhu. Je však dôležité zdôrazniť možnosť, že tieto rozdiely môžu byť spôsobené aj odstránením Avpr1as v regiónoch mimo SBNN alebo ako výsledok kompenzácie rozvoja. Údaje získané pomocou prístupu KO však naznačujú niekoľko fascinujúcich otázok o domnelých funkciách Avpr1a na úrovni okruhu, ktoré si zaslúžia budúcu štúdiu. Napríklad, či Avpr1as fungujúci naprieč okruhom slúži na inhibíciu prejavu aspoň nejakého sociálneho správania, aj keď ich aktivácia v konkrétnych individuálnych uzloch môže vyvolať toto správanie? Sú rozdiely medzi pohlaviami v agresii výsledkom rozdielov medzi pohlaviami v účinkoch Avpr1a naprieč SBNN s aktiváciou Avp1ar, ktorá znižuje agresiu u škrečkov M a zvyšuje agresiu u škrečkov F?
    Fenotyp škrečkov Avpr1a KO sa tiež veľmi líši od fenotypu myší Avpr1a KO, čo naznačuje, že existujú dôležité druhové rozdiely vo funkcii Avpr1a a / alebo kompenzačných mechanizmoch. Škrečky M a F Avpr1a KO boli agresívnejšie ako škrečky WT, zatiaľ čo myši Avpr1a KO M nevykazovali žiadne rozdiely v agresii od WT ( 14 ). Zvýšenie agresivity u škrečkov Avpr1a KO v porovnaní s WT je informované sprievodným zvýšením pachom stimulovaného znakovania boku, čo naznačuje možnú existenciu precitlivenosti na sociálne čuchové stimuly a/alebo hyperreaktivity na sociálne čuchové podnety v hlavnom čuchovom systéme ( 43 ). naproti tomuAvpr1a KO myši vykazujú znížené sociálne vyšetrovanie a zhoršené čuchové spracovanie v porovnaní s WT ( 14 , 44 ). Celkovo tieto porovnania naznačujú, že keďže CRISPR-Cas9 a súvisiace technológie na úpravu génov sa naďalej aplikujú na nové druhy a génové ciele, bude sa naďalej objavovať viac druhovo špecifických rozdielov v génovej funkcii a vývojovej kompenzácii. Tieto údaje určite zdôrazňujú potrebu použitia druhov okrem myší na skúmanie úlohy špecifických neurochemických signálnych dráh pri vytváraní sociálneho správania.
    Jedným kritickým aspektom genetických modelov je určenie vplyvu génu (alebo jeho nedostatku) počas vývoja (prehľad v odkaze 45 ). Je ťažké alebo nemožné oddeliť akútne účinky eliminácie génu od jeho vývojových účinkov v modeloch KO cicavcov, možno najvýraznejšie v potenciálnej vývojovej kompenzácii. Napríklad je možné, že pachom stimulované označenie boku u škrečkov Avpr1a KO je „zachránené“ inými receptormi. Dvaja zrejmí kandidáti na kompenzáciu sú Oxtr alebo Avpr1b. Avšak vzhľadom na to, že AVP, ktorý viaže a aktivuje Oxtr a Avpr1b ( 46 , 47), nestimulovalo značenie boku v KO, toto vysvetlenie je nepravdepodobné. Aj keď sme nenašli žiadne rozdiely v hustote väzby Oxtr v skúmaných mozgových jadrách, vzhľadom na silné prepojenie medzi systémami OT a AVP je možné, že v systéme Oxtr u škrečkov Avpr1a KO sa vyskytli nejaké vývojové poruchy. Vírusové záchranné stratégie ponúkajú potenciál analyzovať vývojové a aktivačné vplyvy Avpr1a KO (pozri príklad 48 ). Potenciálne vývojové dôsledky nedostatku Avpr1a budú dôležitým cieľom a úvahou v budúcom výskume s použitím škrečkov Avpr1a KO.
    Na záver, neočakávané behaviorálne fenotypy Avpr1a KO sýrskych škrečkov odhaľujú pohľad na funkciu Avpr1as pri uľahčovaní sociálneho správania. Dlho sa predpokladalo, že aktivácia Avpr1a bola nevyhnutná aj dostatočná na vyjadrenie označenia boku, ale teraz sa zdá, že označenie boku sa môže v určitých situáciách vyskytnúť aj bez aktivácie Avpr1a. To vyvoláva nové otázky týkajúce sa mechanizmov sociálnej komunikácie, ktoré nie sú sprostredkované Avpr1a. Génom upravené škrečky budú dôležitým nástrojom v týchto budúcich štúdiách.

    Materiály a metódy

    Všetky postupy boli schválené Inštitucionálnym výborom pre starostlivosť o zvieratá a používanie zvierat pri Štátnej univerzite v Georgii a boli v súlade s NIH Guide for the Care and Use of Laboratory Animals ( 49 ), ako aj so Zákonom o ochrane zvierat, zákonníkom federálnych predpisov. Program starostlivosti a používania zvierat Georgia State University je plne akreditovaný AAALAC International. Sýrske škrečky ( M. auratus ) boli zakúpené od Charles River Laboratories, umiestnené v cykle 14 hodín svetlo/10 hodín tma a poskytovali im potravu a vodu ad libitum.

    Konštrukty CRISPR-Cas9, odber embryí, pronukleárne mikroinjekcie a prenos embryí.

    Aby sa vytvorili nehomologické mutácie na spájanie koncov sprostredkované CRISPR-Cas9, bola navrhnutá sgRNA, ktorá sa zamerala na štartovací kodón génu Avpr1a škrečka . Webový nástroj CHOPCHOP ( 50 ) sa použil na vyhľadávanie motívu G(N)20GG oproti publikovanému genómu škrečka ( https://www.ncbi.nlm.nih.gov/genome/11998 ). Vybraná sgRNA ( tabuľka 1 ) sa potom klonovala do bicistrónneho plazmidu pX330-U6-Chimeric_BB_CBh_hSpCas9 (Addgene ID 42230), ako je opísané ( 51 , 52 ), s použitím súpravy NEBuilder HiFi DNA Assembly. Tento plazmid AVPR1A sgRNA/Cas9 sa potom kvantifikoval a pripravil na injekciu.
    Škrečky F, 3-mesačné, boli indukované k superovulácii intraperitoneálnou (IP) injekciou 20 IU sérového gonadotropínu gravidných kobýl (PMSG; EMD Millipore) ráno v deň postestrálneho výtoku. Spárili sa so pohlavne dospelými škrečkami M 82 hodín po injekcii PMSG. Zygoty sa odobrali z vajcovodov -20 hodín po ručnom párení a kultivovali sa v médiu M199TE pri 37,5 °C, 10 % C02 , 5 % O2 a 85 % N2 Plazmid Avpr1a sgRNA/Cas9 (2,5 ng/ul) bol injikovaný do pronuklea zygot. Injikované embryá sa inkubovali v médiu M199TE na zotavenie počas 1 hodiny a potom sa premyli cez médium M2 a preniesli do vajcovodov pseudogravidných škrečkov ( 53 , 54 ).

    Genotypizácia.

    Oblasť genómu obsahujúca miesto delécie bola amplifikovaná z ušných dierovačov (Qiagen, katalógové č. 69504) s použitím nasledujúcich podmienok PCR: 0,5 až 2 μl genómovej DNA, 1 μl priameho priméru (10 mM; 5'-TTTAGGGCACGGGTCTTTG-3′ ), 1 ul reverzného priméru (10 mM; 5'-GGCTCGGGAAATGGTCTTTA-3') a 21 až 22,5 ul PCR Supermix (katalógové č. 12532024). Podmienky termocykléra boli nasledovné: 1) 95 °C počas 2 minút, 2) 95 °C počas 30 s, 3) 59 °C počas 30 s, 4) 68 °C počas 1 minúty, 5) opakujte kroky 2 až 4 40x a 5) 68 °C počas 10 minút. Amplikóny očakávanej dĺžky sa potom buď subklonovali a sekvenovali alebo sekvenovali ako purifikované produkty PCR. Potenciál na úpravu CRISPR-Cas9 na miestach mimo cieľového génu sa vyhodnotil po dvoch kríženiach u potomkov F3 a F4. Genomická RNA (gRNA) plus každé potenciálne miesto s protospacer-adjacentným motívom (PAM) (AGG, GGG,gény M. auratus . Potenciálne mimocieľové miesta sa hodnotili pomocou PCR amplifikácie a sekvenovania, ak sa výsledky nachádzali v kódujúcej oblasti génu a zhodovali sa s trojnukleotidovým miestom PAM a poslednými deviatimi nukleotidmi gRNA dotazu.

    Predmety, chov a bývanie.

    Jediný zakladateľ F bol vyšľachtený na produkciu dvoch vrhov od samcov WT. Potomkovia boli prevedení na WT ďalšie dve generácie. Heterozygoti M a F z F3 sa krížili, aby sa vytvorili WT, heterozygoti a KO. Všetky subjekty použité na zber údajov boli z F3 alebo ich potomkov. WT generované z krížení heterozygot × heterozygot alebo heterozygot × WT sa použili vždy, keď to bolo možné, ale niektoré WT boli z vrhov WT alebo zakúpené od Charles River Laboratories. Všetky subjekty boli umiestnené jednotlivo najmenej 14 dní pred behaviorálnym testovaním. Estrusové cykly sa denne monitorovali prostredníctvom vaginálneho výtoku a denne sa manipulovalo aj s M škrečkami. Odstavčatá boli chované v skupinách rovnakého pohlavia po troch až šiestich až do dospelosti.

    Autorádiografia a kvantifikácia receptorov.

    Mozgy zvierat Avpr1a KO, heterozygotov a WT boli spracované tak, ako je opísané ( 6 ). Jadrá merané pre Avpr1a boli BNST, LS, MPN, AH, VMH, PVN. a AD; a jadrá pre Oxtr boli DEn, AH, MPN a CeA. Tkanivo v rovnakých sekciách ako tie, ktoré boli kvantifikované pre väzbu na receptor, ktoré neboli husté vo väzbe Avpr1a alebo Oxtr v tkanivách WT (tj caudatum, putamen alebo ventromediálny talamus), sa odčítalo, aby sa získal odhad špecifickej väzby. Väzbové hustoty sa spriemerovali na oboch hemisférach a odobrali sa vzorky aspoň dvoch rezov na mozog, na jadro.

    Krvný tlak.

    Systolický krvný tlak sa meral pomocou neinvazívneho monitora krvného tlaku Muromachi 50370 so stredne veľkou manžetou na škrečky. Škrečky M a F WT (7 F, 7 M) a KO (5 F, 6 M) boli anestetizované 2 % izofluránom, kým sa nepohybovali. Škrečky boli umiestnené do polohy na chrbte a tepelne podopreté. Izofluran znižuje krvný tlak, takže merania sa uskutočňovali nepretržite, kým sa systolický krvný tlak nestabilizoval. Potom bol IP injikovaný fyziologický roztok v objeme 1 ml na kg telesnej hmotnosti. Uskutočnilo sa desať meraní (trvanie ~ 10 minút) a potom sa IP injikoval selektívny agonista Avpr1a Phe2OVT (Bachem; Chemical Abstracts Service č. 2480-41-3) na kontralaterálnu stranu v objeme 1 ml na kg tela. hmotnosť a dávka 3 mg na kg telesnej hmotnosti, po ktorej nasledovalo 10 meraní krvného tlaku.

    Operácie kanylácie mozgu.

    Subjekty sa anestetizovali izofluránom a umiestnili sa do stereotaxického zariadenia. Po vyrovnaní lebky sa vyvŕtala jedna diera a implantovala sa 4 mm vodiaca kanyla zameraná na laterálnu komoru (ICV: uhol 0°, +0,8 mm vpredu od bregmy, ±1,4 mm od strednej čiary, -2,8 mm ventrálne od horná časť lebky, dĺžka kanyly 1,2 mm za vodidlom). Boli implantované upevňovacie skrutky z nehrdzavejúcej ocele a hardvér bol pripevnený dentálnym akrylom. Ketoprofén (5 mg/kg) bol podaný pred prvým rezom a znova o 24 hodín neskôr. Subjektom bolo umožnené aspoň 3 dni zotavenia pred začatím testovania správania. Po testovaní boli škrečky usmrtené nadmernou dávkou pentobarbitalu sodného a bol im vstreknutý atrament, aby sa overilo správne umiestnenie kanyly.

    Behaviorálne testovanie.

    Značenie boku spôsobené liekom.

    Bezprostredne pred testovaním bol subjektom infúzne podávaný buď AVP (Sigma; 0,9 μM), selektívny agonista Avpr1a Phe2OVT (dar od Mauricea Manninga, The University of Toledo College of Medicine and Life Sciences, Toledo, OH; 0,27 μM), alebo fyziologický roztok, každý v objeme 1 000 nL. Potom sa umiestnili do čistej klietky a pozorovali sa 10 minút. Medzi medikamentóznou liečbou uplynuli štyri dni (jeden estrusový cyklus). U škrečkov F sa denne monitoroval estrusový cyklus podľa prítomnosti a kvality vaginálneho výtoku. M škrečky boli zapriahnuté do škrečkov F a denne sa s nimi manipulovalo a testovali sa v rovnakých dňoch ako škrečky F. Pozorovania správania vo všetkých experimentoch sa vyskytli počas prvých 3 hodín fázy tmy.

    Pachom stimulované označenie boku.

    Subjekty boli vystavené na 10 minút klietke, ktorá bola 40 až 50-krát označená na boku novým, konšpecifickým pre rovnaké pohlavie ( obr. 6 B ). Značky na boku sa zaznamenali, keď subjekt pritlačil svoje bočné žľazy na steny klietky a posunul sa dopredu. V inom experimente s použitím dizajnu medzi subjektmi boli škrečky M a F KO a WT vystavené čistej klietke alebo klietke so zápachom. Testovanie sa uskutočnilo na druhý deň diestru u škrečkov F.
    Obr.
    Schéma experimentálnych časových línií pre liekmi vyvolané označovanie boku ( A ) a označovanie boku stimulované agresiou ( B ). M škrečky boli zapriahnuté do škrečkov F a testované v rovnakých dňoch.
    OTVORIŤ V PREHRÁVAČI

    Agresia v neutrálnej aréne.

    Na testovanie agresie bola použitá neutrálna aréna, aby boli údaje porovnateľné s predchádzajúcou štúdiou na myšiach Avpr1a KO M ( 14 ). Tri dni po testovaní na označovanie boku stimulovaného zápachom ( obr. 6 B ) boli subjekty umiestnené do čistej klietky s menšou, v skupine umiestnenou, konšpecifickou osobou rovnakého pohlavia, pozorované počas 5 minút a hodnotené ako agresívne správanie (celkové trvanie : prenasledovanie, hryzenie a prichytávanie).

    Analýza dát.

    Väzba Avpr1a a Oxtr.

    Testovali sme hypotézu, že genómové narušenie génu Avpr1a má za následok nedostatok špecifickej väzby Avpr1a v mozgu u škrečkov M a F ( Avpr1a KO: 3 M, 3 F; heterozygot: 3 M, 3 F; a WT: 3 M , 2 F). Väzbové hustoty pre Avpr1a a Oxtr sa analyzovali pomocou ANOVA 2 (pohlavie) x 3 (genotyp). Boli vykonané vhodné post hoc testy Fisherovho najmenšieho významného rozdielu (LSD), aby sa zistili významné hlavné účinky a interakcie.

    Systolický krvný tlak.

    Skúmali sme, či sú Avpr1as na periférii zodpovedné za presorické reakcie na vazopresín u škrečkov M a F (WT: n = 7 M, 7 F; a KO: n = 6 M, 5 F). Systolický krvný tlak po liečbe fyziologickým roztokom a Phe2OVT sa analyzoval pomocou zmiešanej ANOVA 2 (pohlavie) x 2 (genotyp) x 2 (liečba) x 10 (meranie). Uskutočnili sa príslušné Fisherove post hoc testy LSD na testovanie významných hlavných účinkov a interakcií.

    AVP-stimulované označenie boku.

    Testovali sme hypotézu, že v neprítomnosti Avpr1a AVP neindukuje označovanie boku u škrečkov. Škrečky KO ( n = 5 M, 4 F) a WT ( n = 5 M, 4 F) boli vystavené liekom indukovaným postupom označovania boku opísaným vyššie po ICV liečbe s AVP, Phe2OVT alebo fyziologickým roztokom. Značenie boku sa analyzovalo pomocou 2 (pohlavie) x 2 (genotyp) x 3 (liečba) zmiešaných ANOVA. Uskutočnili sa príslušné Fisherove post hoc testy LSD na testovanie významných hlavných účinkov a interakcií.

    Pachom stimulované značenie na boku a agresivita osôb rovnakého pohlavia.

    Testovali sme hypotézu, že Avpr1a je potrebný na expresiu označenia boku u škrečkov KO M a F a že aktivácia Avpr1a zvyšuje expresiu agresie u škrečkov M. WT ( n = 6 M, 5 F), heterozygot ( n = 6 M, 15 F) a KO ( n = 8 M, 7 F) škrečky M a F boli vystavené pachom stimulovanému značeniu boku (WT = 6 M, 5 F; heterozygot = 6 M, 15 F; KO = 8 M, 7 F) a agresia v neutrálnej aréne (WT = 5 M, 6 F; heterozygot = 6 M, 15 F; KO = 8 M, 7 F) postupy opísané vyššie. Značenie boku a agresivita sa analyzovali pomocou 2 (pohlavie) x 3 (genotyp) zmiešaných ANOVA. Uskutočnili sa príslušné Fisherove post hoc testy LSD na testovanie významných hlavných účinkov a interakcií.

    podporujúce informácie

    V anglickom jazyku: https://www.pnas.org/doi/10.1073/pnas.2121037119

    Na rozdiel od mnohých iných nemá Oz Dôstojnosť Slovenska žiadnych akcionárov ani miliardárskeho vlastníka. Len odhodlanie a vášeň poskytovať nielen vysoko účinné globálne spravodajstvo, vždy bez komerčného alebo politického vplyvu. Takéto podávanie správ je životne dôležité pre demokraciu, spravodlivosť a požiadavku na lepšie od mocných.

    A to všetko poskytujeme zadarmo, aby si to mohol prečítať každý. Robíme to preto, lebo veríme v informačnú rovnosť. Väčšie množstvo ľudí môže sledovať globálne udalosti, ktoré formujú náš svet, pochopiť ich vplyv na ľudí a komunity a inšpirovať sa k zmysluplným krokom. Milióny ľudí môžu ťažiť z otvoreného prístupu ku kvalitným a pravdivým správam bez ohľadu na ich schopnosť zaplatiť za ne.

    Položili ste si niekedy otázku, prečo je stále viac ľudí chorých, hoci medicína a ochrana životného prostredia stále tvrdia, že je lepšie a lepšie? 

    Zamysleli ste sa niekedy nad tým, prečo sú voľby zbytočné? 

    Premýšľali ste niekedy nad tým, prečo je všetko otočené hore nohami? 

    Táto práca stavia most k traume, do ktorej sme nútení a z ktorej sa môžeme oslobodiť až po prebudení.

    Spracoval: ® OZ Dôstojnosť Slovensko Všetky práva vyhradené!!

    Ak sa vám páči naša práca....podporte nás. Nie sme financovaní a nedostávame žiadne granty od štátu a ani od politických strán či hnutí - čo je pre nás tiež veľmi dôležité z hľadiska zachovania našej nezávislosti. Všetko iba z vlastných zdrojov. Vopred ďakujeme za vašu podporu a priazeň

    Neziskový sektor: SLSP

    Názov účtu: Dôstojnosť Slovenska

    SK28 0900 0000 0051 7971 8989

    Všetky práva vyhradené OZ Dôstojnosť Slovenska. Zdieľanie dovolené.

    V spolupráci s mpr21 a zahraničné agentúry v ktorých sme registrovaní
     

    © DostojneSlovensko.eu 2021
    Všetky práva vyhradené.

    https://www.facebook.com/dostojnostslovenska